Eur J Endocrinol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

DOI: 10.1530/eje.1.02307
European Journal of Endocrinology, Vol 155, Issue 6, 849-857
Copyright © 2006 by European Society of Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Toole, D.
Right arrow Articles by Barlier, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Toole, D.
Right arrow Articles by Barlier, A.
CLINICAL STUDY

The analysis of quantitative expression of somatostatin and dopamine receptors in gastro-entero-pancreatic tumours opens new therapeutic strategies

Dermot O’Toole1,*, Alexandru Saveanu3,4,*, Anne Couvelard2, Ginette Gunz3, Alain Enjalbert3,4, Philippe Jaquet3, Philippe Ruszniewski1 and Anne Barlier3,4

1 Service of Gastroentérologie-Pancréatologie, Pôle de maladies de l’appareil Digestif and 2 Service of Anatomo-pathologie, Hôpital Beaujon, Clichy, France, 3 Laboratory Interactions Cellulaires Neuroendocriniennes, CNRS-UMR6544, Institut Fédératif Jean-Roche, Faculté de Médecine Nord, Université de la Méditerranée, Marseille, France and 4 Laboratory of Biochemistry and Molecular Biology, Centre Hospitalo-Universitaire Conception, Marseille, France

(Correspondence should be addressed to A Barlier at Laboratory Interactions Cellulaires Neuroendocriniennes, CNRS-UMR6544, Institut Fédératif Jean-Roche, Marseille, France; Email: barlier.a{at}jean-roche.univ-mrs.fr)


   Abstract
Top
 Footnotes
 Abstract
Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Objective: Somatostatin (sst) are present in the majority of gastro-entero-pancreatic (GEP) tumours. Effects of somatostatin receptor (sst) analogues are partial and of limited duration. Cell lines derived from GEP express dopaminergic receptors D2. New chimeric analogues simultaneously recognising sst2 and sst5 or sst2 and D2 have additive effects in inhibition of GH and prolactin secretion in pituitary adenomas. Our aim was to quantify the expression of sst and D2 mRNA in human GEP tumours.

Design and methods: mRNA expression of sst1, sst2, sst3 and sst5 as well as D2, was analysed using real-time PCR (TaqMan probe) in a series of 35 patients with GEP tumours (pancreas (n = 19) and intestinal (n = 16)). Levels of expression were compared with a group of 13 somatotroph adenomas.

Results: All GEP tumours express sst1, sst2 and D2. Expression of sst3 and sst5 was observed in 89 and 76% of tumours respectively with highly variable levels. sst2 mRNA expression was higher in nonfunctional tumours (P < 0.009) and sst5 was higher in pancreatic than in intestinal tumours (P < 0.02). Whereas sst2 levels were similar between GEP and somatotroph tumours, levels of sst5 and D2 were higher in the former (394.9 ± 156.1 x 10–2 vs 69.7 ± 19.5 x 10–2 copy/copy ß-Gus (P < 0.0036) and 519.6 ± 121.2 x 10–2 vs 50.0 ± 21.6 x 10–2 copy/copy ß-Gus (P < 0.0001) respectively). In small tumours ( < 30 mm), sst2 density appeared as a crucial parameter in somatostatin receptor scintigraphy results, whereas in big tumours, a consistent bias in SRS results was introduced by the size. In pancreatic GEP, high-level sst3 expression was found in tumours with more active angiogenesis (higher microvessel density and vascular endothelial growth factor expression (P < 0.03)).

Conclusions: GEP tumours co-express sst2 and D2 in 100% of cases and sst5 in 89% thus supporting the testing of bi-specific agonists (sst2/sst5 or sst2/D2) in these tumours.


   Introduction
Top
 Footnotes
 Abstract
 Introduction
Subjects and methods
 Results
 Discussion
 References
 
Somatostatin receptor (sst) subtype status has been characterised using various techniques in gastro-entero-pancreatic (GEP) tumours, however, results are heterogeneous and depend on tumour types (1–4). Relatively, few data are available concerning semi-quantitative sst expression from studies using densitometry from autoradiography, immunohistochemistry and RT-PCR analysis (3, 5, 6). Differential expression of sst subtypes, but especially sst2, appears important in predicting results of somatostatin receptor scintigraphy (SRS) and therapeutic response to cold somatostatin analogues (7–13). A good correlation has been found to exist between RT-PCR and immunohistochemistry in GEP tumours indicating that the former method may indeed be sufficiently accurate in detecting sst subtypes (5). Real-time PCR adds a quantitative dimension to receptor mRNA detection.

Therapy using standard somatostatin analogues (either daily octreotide or slow-release depot preparations; Octreotide LAR and SR-Lanreotide, sst2 agonist) in patients with functional GEP is not universally efficacious and the effects of treatment wane with time (14). Ligands with enhanced receptor binding or those recognising several receptor subtypes may improve clinical outcome and perhaps offer an effective anti-tumoural benefit. BIM-23 244, a somatostatin receptor subtypes 2 and 5 selective analogue was found to have enhanced efficacy in suppressing growth hormone from octreotide-resistant human growth hormone-secreting pituitary adenomas (15). Recently, a multivalent ligand, SOM230, capable of binding to sst1, sst2, sst3 and sst5, has been developed with promising results in treatment of patients with acromegaly (16, 17) and trials are on-going in patients with symptomatic GEP tumours resistant to standard somatostatin analogue therapy. Better knowledge of sst receptor status in these patients may allow for a tailored approach using such compounds and indeed, quantitative receptor expression may correlate with clinical outcome. A further interesting concept stemmed from combined receptor targeting as demonstrated by the enhanced potency of a chimeric somatostatin–dopamine molecule, BIM-23A387, in suppressing growth hormone and prolactin secretion from human pituitary somatotroph adenoma cells in vitro (18, 19). Here, the chimeric compound was far more potent than standard somatostatin or dopamine analogues alone (18). Although D2 receptors (D2) have been found in the neuroendocrine tumour cell lines, SCAT and BON-1 (20), no data are available in patients with GEP tumours.

The purpose of this study was to quantify sst and D2 receptors mRNA using real-time PCR in a group of patients with GEP tumours originating from the pancreas and small intestine with detailed clinical data available for comparative analysis. The results were compared with a group of patients with somatotroph adenomas.


   Subjects and methods
Top
 Footnotes
 Abstract
 Introduction
 Subjects and methods
Results
 Discussion
 References
 
The study was carried out in 35 patients with GEP tumours (19 men and 16 women), aged 51 ± 14.7 years. The present study was approved by the ethics committee of the university and was undertaken after informed consent was obtained from each patient and all participants. The analysis involved only the primary tumour, which had been surgically resected and detailed clinical and pathological characteristics were available in all patients. After surgery, a portion of each tumour tissue was analysed in terms of the quantitative expression of mRNA for the D2 and for sst1, sst2, sst3 and sst5 receptor subtypes. The primary tumour location included: pancreas (n = 19) and intestine (n = 16): ileum, 13; jejunum, 2 and duodenum, 1. The following tumour characteristics were recorded: size (largest perpendicular diameter), functional status (presence or absence of symptoms from hormonal overproduction), SRS results, histological differentiation and WHO status (21). General clinical and tumour characteristics of patients are summarised in Table 1Go.


View this table:
[in this window]
[in a new window]

  		Table 1 Patient’s and tumour characteristics.
 
Quantitative expression of mRNA for receptors targeted by actual somatostatin and dopamine agonists (sst2 and sst5 and D2) were compared in patients with GEP tumours to a group of 13 patients with somatotroph adenomas, characterised by immunocytochemistry.

VEGF and microvascular density estimation

The vascular endothelial growth factor (VEGF) protein was detected by the murine MAB VG1 (22) in pancreatic tumours using a methodology described recently (23) PBS was substituted for primary antibody as the negative control. Positive controls consisted of serum in blood vessels and of islets (detected with strong intensity) in non-tumoural pancreas (adjacent to the tumours). All sections were performed in the same run. The specimens were scanned at a low optical power ( x 40) to study the tissue distribution of staining and at a high optical power ( x 250) to study the cellular staining patterns. The percentage of cells with positive reactivity was scored. A cytoplasmic score was calculated by multiplication of the percentage of cytoplasmic-stained cells by their staining intensity (negative scored as 0, weak scored as 1, moderate scored as 2 and strong scored as 3) (23) Microvessel counting was also only available for pancreatic tumours and was performed on x 200 fields (area of a x 200 field: 0.442/mm2) after CD34 staining. Two areas of high vascularisation were chosen for microvessel counting at a low optical power ( x 40). The final microvessel density (MVD) was the mean value of 3 appraised fields in each area (total area: 2.65/mm2). Vessels with a clearly defined lumen or well-defined linear vessel shape were taken into consideration for counting. In addition, the cellular proliferation index, Ki-67 (%), was calculated using a murine monoclonal MIB-1 antibody (DAKO, Trappes, France) as described previously (23).

Detection of somatostatin receptor and D2 mRNAs

Total RNA was extracted from 30 to 60 mg tissue from each tumour using the RNAeasy isolation system (QIAGEN). Tissue sampling was carefully evaluated at microscopy to ensure that sampling was from tumoural tissue and not from adjacent tissues. One microgram of total RNA prepared from tumoural tissues was used for cDNA synthesis with 200 U Superscript II reverse transcriptase (Life Technologies, Inc.) primed with 300 ng random primer (18).

The 5' exonuclease (TaqMan) assay, which produces a direct proportional readout for the progression of PCR, was used. Amplification of cDNA derived from 50 to 150 ng total RNA was performed in a 25 µl reaction volume with 300 nM of each primer, 200 nM probe and 12.5 µl MasterMix (PE Applied Biosystems, Paris, France). The synthetic sst1, sst2, sst3, sst5 and D2 primers and TaqMan probes used in the PCR were described previously (18, 24) and were follows (forward (F), reverse (R) primers and probe (P)):

D2 F: CAAGACCATGAGCCGTAGGAAG, R: TGTGTG-TGATGAAGAAGGGCAG, P: CCCAGCAGAAGGAGAA-GAAAGCCACTCA; sst1 F: GCTAGGACACTGACAG-CCTTTGA, R: GTAGCCTGAAAGCCTTCCCA, P: CCCAA-GAAAGGCGCGCGACAAT; sst2 F: GCCTCCAGGGTCCAT-TAAGG, R: ATTGAGTGGCTCATCCGCC, P: AGAATA-AGATCTCTGGGCTGGCTGGAA; sst3 F: TGGGCCTGCTG-GGTAACT, R: GATGTAGACGTTGGTGACTGAAGG, P: CATCTATGTGGTCCTGCGGCACACG; sst5 F: CTGGTG-CCAAGGACGCT, R: GCTGCCGGATCCTGTCTG, P: ACGC-CACGGAGCCGCGT. Forty cycles of two-step PCR-annealing extension were performed on an ABI Prism 7700 sequence detection apparatus (PE Applied Biosystems, Paris, France). The sst and D2 mRNA levels were normalised to the ß-Gus mRNA levels obtained in the same reaction. The ß-Gus primers and probe were purchased from PE Applied Biosystems (18). For each measurement, three independent RT-PCR analyses were performed. To produce standard curves for sst, D2 and ß-Gus mRNA, cDNA constructs were produced for each parameter and verified by sequencing. The results were expressed as copy of sst or D2/copy of ß-Gus.

Statistical analysis

The results are presented as the mean ± S.E.M. Statistical significance between two unpaired groups was determined by the Mann–Whitney U test. A P value less than 0.05 was considered significant for all tests.


   Results
Top
 Footnotes
 Abstract
 Introduction
 Subjects and methods
 Results
Discussion
 References
 
sst and D2 mRNA expression in GEP tumours

All GEP tumours had constant but variable expression of sst1, sst2 and D2 (Fig. 1Go; Table 2Go). Somatostatin receptor subtypes sst3 and sst5 were expressed in 76 and 89% of GEP tumours respectively (Table 2Go). mRNA level expression of sst5 was higher in pancreatic than in intestinal tumours (P < 0.02); mRNA level expression of sst2 was also higher in pancreatic than in intestinal GEP; however, this did not achieve statistical significance (Table 2Go; Fig. 2Go).


Figure 1
View larger version (13K):
[in this window]
[in a new window]

  		Figure 1 sst1, sst2, sst3, sst5 and D2 mRNA levels in 35 GEP tumours (19 pancreatic and 16 intestinal). The quantification was performed by real-time PCR. Measurements were reported to the level of ß-Gus.

 

View this table:
[in this window]
[in a new window]

  		Table 2 Expression levels of sst1, sst2, sst3, sst5 and D2 in GEP tumours and in pituitary adenomas.
 

Figure 2
View larger version (11K):
[in this window]
[in a new window]

  		Figure 2 Comparison of mRNA expression levels of sst2, sst5 and D2 mRNA between 19 pancreatic and 16 intestinal tumours. The quantification was performed by real-time PCR. Measurements were reported to the level of ß-Gus. *P < 0.02.

 
The level of mRNA sst2 expression was significantly higher in patients with non-functional tumours (n = 19) compared with functional tumours (n = 16, 91.7 ± 37.4 x 10–2 vs 39.9 ± 19.7 x 10–2 copy/copy ß-Gus, P < 0.009).

Comparison with somatotroph adenomas

Somatostatin receptor subtypes sst2, sst5 and D2 mRNA levels were compared with a group of 13 somatotroph adenomas (Fig. 3Go). Levels of sst5 and D2 mRNA were significantly higher in pituitary adenomas compared with GEP tumours (P < 0.0036 and P < 0.0001 respectively), whereas sst2 mRNA levels were similar. Levels of sst5 and D2 mRNA were in the range of those observed in somatotroph adenomas in 43 and 17% of GEP tumours respectively.


Figure 3
View larger version (8K):
[in this window]
[in a new window]

  		Figure 3 Comparison of mRNA expression level of sst2, sst5 and D2 mRNA between 35 GEP tumours and 13 somatotroph adenomas (GH). Quantification was performed by real-time PCR. Measurements were reported to the level of ß-Gus. *P < 0.0036; {dagger}P < 0.0001.

 
sst expression compared with tumour stage and SRS status

Level of mRNA for sst2 and sst3 was significantly higher in WHO stages 1–2 compared with stage 3 (115 ± 48 x 10–2 vs 60 ± 22 x 10–2 (P < 0.03) and 17 ± 7 x 10–2 vs 4 ± 2.4 x 10–2 (P < 0.00 673) copy/copy ß-Gus respectively). However, as the majority of intestinal tumours tested were stage 3, this analysis may be biased by the tumour type. These differences were not apparent when pancreatic tumours were considered alone (n = 8, 115 ± 48 x 10–2 vs n = 9, 91 ± 43 x 10–2 copy/copy ß-Gus) thus confirming that these effects may be attributable to tumour type alone. mRNA levels of sst2 and sst5 were also compared with SRS results (available in 34 patients, Table 1Go): sst2 levels were higher in SRS-positive (n = 27) than in SRS-negative (n = 7) tumours (87.1 ± 26.3 x 10–2 and 28.4 ± 10.6 x 10–2 copy/copy ß-Gus) without achieving statistical significance. However, when small tumours were considered ( < 30 mm; n = 16) receptor density clearly influenced SRS results: ten SRS-positive patients had a mean sst2 density of 128.3 ± 48.6 x 10–2 vs 31.2 ± 12.1 x 10–2 copy/copy ß-Gus (P < 0.05) in six SRS-negative tumours (Fig. 4Go). Expression of other receptor subtypes had no influence on SRS results, in fact, mean sst5 receptor levels were higher in SRS-negative than in SRS-positive tumours (109.9 ± 65.9 x 10–2 vs 59.4 ± 19.0 x 10–2 copy/copy ß-Gus) however, not statistically significant.


Figure 4
View larger version (8K):
[in this window]
[in a new window]

  		Figure 4 mRNA level expression of sst2 in small GEP tumours ( < 30 mm) according to the SRS-positive (n = 10) or SRS-negative patients (n = 6). The quantification was performed by real-time PCR. Measurements were reported to the level of ß-Gus. *P < 0.05.

 
sst and D2 expression compared with vascular markers and Ki-67 in pancreatic tumours

sst and D2 were then analysed with respect to vascular markers, MVD and VEGF, in pancreatic tumours (Table 3Go). The MVD ranged from 80 to 674 vessels/mm2 (329 ± 44). The VEGF score ranged from 0 to 180 (58.4 ± 14.3). No correlations were found between MVD and VEGF in relation to sst1, sst2, sst5 and D2 receptors. When pancreatic tumours were classified into two groups expressing high-level sst3 (n = 7, 24 ± 5 x 10–2 copy/copy ß-Gus) and tumours not expressing or expressing low-level sst3 (n = 12, 0.6 ± 0.3 x 10–2 copy/copy ß-Gus), MVD and VEGFexpression were significantly higher in the high-level sst3 group (428 ± 70 vs 236 ± 41 vessels/mm2 and 94 ± 25.8 vs 24.5 ± 7.4 respectively, P < 0.03; Fig. 5Go), although general low sst3 expression.


View this table:
[in this window]
[in a new window]

  		Table 3 Expression levels of sst1, sst2, sst3, sst5 and D2 receptors according to the microvascular density (MVD) as measured by microscopy using CD34 staining (vessels/mm2), vascular endothelial growth factor (VEGF, measured as a score by multiplication of the percentage of stained cells by their staining intensity 0) by immunohistochemistry and cellular proliferation index (Ki-67) in 19 pancreatic tumours.
 

Figure 5
View larger version (10K):
[in this window]
[in a new window]

  		Figure 5 Microvascular density (MVD), VEGF score in 19 pancreatic tumours expressing a high level (> 4) or a low level ( < 4) of sst3 mRNA. MVD were evaluated by microscopy, VEGF score by immunocytochemisty (measured as a score by multiplication of the percentage of stained cells by their staining intensity) and sst3 by real-time PCR. *P < 0.03.

 
When tumours were classified into two groups according to the Ki-67 level above 3% (n = 9, 7.2 ± 0.6) or below 3% (n = 8, 2.6 ± 0.3), sst5 levels were found to be higher in first group compared with the second group (25 ± 11.8 x 10–2 vs 206 ± 62 x 10–2 copy/copy ß-Gus, P < 0.005; Fig. 6Go).


Figure 6
View larger version (7K):
[in this window]
[in a new window]

  		Figure 6 Nineteen pancreatic tumours were classified into two groups according to the level of % Ki-67 (above or below 3%).sst5 were evaluated by real-time PCR. *P < 0.005.

 

   Discussion
Top
 Footnotes
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
References
 
Somatostatin analogues are widely used in the treatment of GEP tumours and SRS is a useful tool in diagnosis. The general use of SRIF agonists is justified by the presence in these tumours of SRIF receptors detected by qualitative mRNA and protein methods. For the first time, using real-time PCR, we systematically quantified not only sst subtypes but also D2 mRNA, in a large series of human GEP tumours. All GEP tumours expressed sst1, sst2 and D2 while only 76 and 89% of tumours expressed sst3 and sst5 respectively. These results are close to those of Papotti et al using semi-quantitative PCR and immunohistochemistry with a good correlation between these two techniques (5). In our series, the expression levels were higher for sst2 and sst5 and markedly lower for sst1 and sst3. Note that nonfunctioning GEP tumours had a significantly higher level of sst2 than functional ones (P < 0.009); however, the significance of this remains to be determined. Similar results concerning sst2 and sst5 were also previously observed in 38 patients with GEP (mostly pancreatic) using semi-quantitative PCR, although sst1 and sst3 were less frequently observed (66 and 50% respectively) (3). Compared with a group of pituitary tumours, the level of sst5 mRNA expression was less while sst2 expression levels were almost similar (Table 2Go). In a group of 27 ileal carcinoids, Reubi and Wasser (6) found sst2 to have the highest density (5.4 d.p.m./mg tissue) followed by sst1, sst5, sst3 and sst4 (3.4, 2.4, 1.6 and 1.5 d.p.m./mg tissue respectively). However, comparison of techniques using ligand binding and mRNA detection is difficult. Indeed, techniques focused on protein detection may reflect more accurate levels of sst receptors, whereas PCR may have overestimated quantities expressed. Moreover, the use of PCR does not allow for analysis of the percentage of cells expressing different receptor subtypes which requires in situ hybridisation or immunohistochemistry; indeed, the heterogeneity of sst expression has been previously described (5).

Although the dopamine receptors and the trans-membrane dopamine transporter are known to play an important role in gastrointestinal physiology (25), they have not been investigated in neuroendocrine gastrointestinal tumours. Interestingly, Lemmer et al. have showed the presence of D2 in two cell lines, STC1 murine neuroendocrine gut tumours and BON human pancreatic neuroendocrine tumours (20). Here, we showed for the first time the presence of D2 mRNA in all human GEP tumours. Moreover, the quantitative analysis showed that D2 expression level was in the range of those observed in somatotroph adenomas in 17% of GEP tumours. The identification of D2 in all GEP tumours of both intestinal and pancreatic origin opens the possibility of examining new chimeric analogues which simultaneously recognise sst2 and D2, such as BIM-23A387 or BIM-23A370, which have been shown to enhance the suppression of growth hormone and prolactin in pituitary adenomas compared with sst2 and D2 analogues used alone (18, 26). A direct anti-proliferative effect of the somatostatin/dopamine chimeras, BIM-23A387 and BIM-23A370, was found in the lung carcinoma cell line (Calu-6) possible via sst/D2 dimerisation (27). In addition, other analogues capable of recognising both sst2 and sst5 (BIM-23 244) or the multivalent agonist SOM230 (recognising sst1, sst2, sst3 and sst5) offer the possibility of increasing therapeutic efficacy by acting via more than one receptor. Although D2 was found in all tumours, low levels were expressed in about 80% inferring that D2 receptor targeting may only be relevant to subset of patients with GEP tumours. Moreover, cellular distribution of sst and D2 receptors should also be an important parameter involved in the efficacy of such treatment. Examining the potential effect on tumour secretion or even proliferation in GEP tumours will require functional studies.

Somatostatin receptor scintigraphy is performed not only for tumoural localisation but also for predicting the efficacy of somatostatin agonist or modified radio-pharmaceutical analogues (28–31). However, in some case, SRS results were not correlated with results of treatments (32–34). Actual SRS using 111pentetreotide recognises mostly sst2 subtype. Pentetreotide had tenfold higher affinity for sst2 than for sst5 or sst3 (6). Globally, SRS is positive in approximately 80% of all patients with GEP tumours (35). Previously, semi-quantitative RT-PCR revealed most prominently sst2 expression in scintigraphic positive tumours (36). Using sst2 knockout mice, Hofland and collaborators confirmed the crucial role of sst2 in determining the uptake of [111In DTPA-D-Phe]octreotide (28). In the present study, we confirm sst2 as the most important receptor subtype in case of positive SRS uptake as the levels of sst2 in 27 SRS-positive tumours was markedly higher as compared with seven SRS-negative tumours. Levels of other sst did not differ between SRS-positive and SRS-negative tumours thus confirming that other sst have less influence on SRS outcome (36). Jais et al previously observed no difference in sst receptor distribution and SRS results although again numbers were small (17 positive SRS vs 4 negative) (3). In the present study, when only small tumours ( < 30 mm) were examined, sst2 mRNA level expression was significantly higher in SRS-positive tumours than in SRS-negative ones (Fig. 4Go), thus confirming the crucial role of sst2 receptor alone on scintigraphic results for small tumours. Moreover, compared with SRS-negative tumours, SRS-positive tumours were larger (44 ± 7 vs 21 ± 2.7 mm, P < 0.01, data not shown) confirming the role of tumour size itself on scintigraphic results for the large tumours. Among all SRS-positive tumours, sst2 mRNA levels were significantly higher in the group of small versus big tumours (128 ± 48 x 10–2 vs 73 ± 48 x 10–2 copy/ß-Gus copy, P < 0.05, data not shown) confirming the bias introduced by the size in SRS results.

sst level expression and in particular sst2 may predict clinical response to somatostatin receptor analogues and could thus help in tailoring targeted therapy as shown in somatotroph adenomas (37, 24). As in patients with breast cancer where oestrogen receptor status and levels help in predicting therapeutic responses, quantitative receptor measurements may help in determining responses to cold and radiolabelled somatostatin (or somatostatin–dopamine) analogues to be used in treatment according to analogues binding characteristics (38, 39).

As well as being involved in regulation of hormonal release, sst are known to have direct and indirect effects on angiogenesis and cellular proliferation (review: (40)). Interestingly, sst3 was higher in pancreatic than in intestinal tumours (Table 2Go). Thus, when pancreatic tumours were separated into high and low sst3 level groups, a positive correlation with both microvessel density and VEGF score (P < 0.03) was observed (Fig. 5Go). MVD and VEGF expression have been found to be increased in benign pancreatic tumours and their expression decreases as tumours dedifferentiate (23). sst3 has previously been found to be the predominant somatostatin receptor subtype in endothelial cells (41). sst3 may be expressed also in the microvessels of the tumours of our series. Nevertheless, the observation of co-expression of angiogenic factors with sst3 is important as underlined by the recent observation that somatostatin inhibition of tumour angiogenesis in a Kaposi’s sarcoma cell xenograft model occurred via sst3-mediated inhibition of both nitric oxide synthetase and MAPK activities (42). In endothelial cells-expressing sst3, addition of the sst3 antagonist, BN81658, significantly reversed the anti-angiogenic effects of somatostatin (42). VEGF and somatostatin were also recently found to be co-expressed in the same tissue compartments in ovarian cancer suggesting a major role for somatostatin in angiogenesis (43).

Finally, low sst5 mRNA expression was present in pancreatic tumours with high Ki-67 level. Overall, few data are available comparing sst receptors with cellular markers of proliferation. Interestingly, our results were contradictory to recent data in a series of 16 insulinomas, where sst5 was positively correlated with aggressive tumour behaviours, such as large tumour size, tumours of uncertain behaviour and presence of nuclear atypia (44). In brain tumours (astrocytomas and meninginomas), no relation existed between Ki-67 and sst subtypes in two series (45, 46). In contrast, in breast cancer, sst2 mRNA expression was significantly higher in low-proliferating (as measured using Ki-67) breast cancers (47). Note that in an endothelial cell line model (HUVEC) sst other than sst2 and sst3 appears important in controlling proliferation as demonstrated by the ability of the multivalent ligand SOM230, but not octreotide, to inhibit proliferation and this did not appear to be mediated via sst3 as only sst1, sst2 and sst5 were detected using RT-PCR and western blotting (48). SOM230 or other specific sst2–sst5 or sst2–D2 agonists may thus represent suitable candidates as potential anti-angiogenic and anti-proliferating drugs.

In conclusion, GEP tumours were found to co-express sst2 and D2 in all cases and sst5 in 89%. SRS results were strongly correlated to the sst2 mRNA expression level in small tumours ( < 30 mm), but were consistently distorted by the size in large tumours explaining some discordance between SRS and somatostatin treatment results. While mean level of receptor expression for sst5 and D2 is lower in GEP than in pituitary adenomas, comparative levels are observed in almost a half and a fifth of tumours respectively. These results argue for testing of bi-specific agonists (sst2/sst5 or sst2/D2) in the treatment of GEP tumours not only for inhibiting secretion but also angiogenesis and cell proliferation.


   Funding
 
The present study was supported in part by Biomeasure, Inc. (Milford, MA, USA), by Centre national de la Recherche Scientifique, by the Association pour le Développement des Recherches Médicales au Centre Hospitalier Régional de Marseille (ADEREM) and by an educational grant from Beaufour Ipsen Pharma.


   Footnotes
Top
 Footnotes
Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
* D O’Toole and A Saveanu contributed equally to this work. Back


   References
Top
 Footnotes
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

    1. Kubota A, Yamada Y, Kagimoto S, Shimatsu A, Imamura M, Tsuda K, Imura H, Seino S & Seino Y. Identification of somatostatin receptor subtypes and an implication for the efficacy of somatostatin analogue SMS 201–995 in treatment of human endocrine tumors. Journal of Clinical Investigation 1994 93 1321–1325.[ISI][Medline]

    2. Reubi JC, Waser B, Schaer JC & Laissue JA. Somatostatin receptor sst1–sst5 expression in normal and neoplastic human tissues using receptor autoradiography with subtype-selective ligands. European Journal of Nuclear Medicine 2001 28 836–846.[CrossRef][ISI][Medline]

    3. Jais P, Terris B, Ruszniewski P, Leromancer M, Reyl-Desmars F, Vissuzaine C, Cadiot G, Mignon M & Lewin MJ. Somatostatin receptor subtype gene expression in human endocrine gastro-entero-pancreatic tumours. European Journal of Clinical Investigation 1997 27 639–644.[CrossRef][ISI][Medline]

    4. Volante M, Bozzalla-Cassione F & Papotti M. Somatostatin receptors and their interest in diagnostic pathology. Endocrine Pathology 2004 15 275–291.[CrossRef][ISI][Medline]

    5. Papotti M, Bongiovanni M, Volante M, Allia E, Landolfi S, Helboe L, Schindler M, Cole SL & Bussolati G. Expression of somatostatin receptor types 1–5 in 81 cases of gastrointestinal and pancreatic endocrine tumors. A correlative immunohistochemical and reverse-transcriptase polymerase chain reaction analysis. Virchows Archiv 2002 440 461–475.[CrossRef][ISI][Medline]

    6. Reubi JC & Waser B. Concomitant expression of several peptide receptors in neuroendocrine tumours: molecular basis for in vivo multireceptor tumour targeting. European Journal of Nuclear Medicine and Molecular Imaging 2003 30 781–793.[ISI][Medline]

    7. Lamberts SW, Hofland LJ, Van Koetsveld PM, Reubi JC, Bruining HA, Bakker WH & Krenning EP. Parallel in vivo and in vitro detection of functional somatostatin receptors in human endocrine pancreatic tumors: consequences with regard to diagnosis, localization, and therapy. Journal of Clinical Endocrinology and Metabolism 1990 71 566–574.[Abstract]

    8. Kvols LK, Reubi JC, Horisberger U, Moertel CG, Rubin J & Charboneau JW. The presence of somatostatin receptors in malignant neuroendocrine tumor tissue predicts responsiveness to octreotide. Yale Journal of Biology and Medicine 1992; 65: 505–518 (Discussion 531–506).[ISI][Medline]

    9. Janson ET, Westlin JE, Eriksson B, Ahlstrom H, Nilsson S & Oberg K. [111In-DTPA-D-Phe1]octreotide scintigraphy in patients with carcinoid tumours: the predictive value for somatostatin analogue treatment. European Journal of Endocrinology 1994 131 577–581.[Abstract]

    10. Janson ET, Stridsberg M, Gobl A, Westlin JE & Oberg K. Determination of somatostatin receptor subtype 2 in carcinoid tumors by immunohistochemical investigation with somatostatin receptor subtype 2 antibodies. Cancer Research 1998 58 2375–2378.[Abstract/Free Full Text]

    11. Hofland LJ, Liu Q, Van Koetsveld PM, Zuijderwijk J, Van Der Ham F, De Krijger RR, Schonbrunn A & Lamberts SW. Immunohistochemical detection of somatostatin receptor subtypes sst1 and sst2A in human somatostatin receptor positive tumors. Journal of Clinical Endocrinology and Metabolism 1999 84 775–780.[Abstract/Free Full Text]

    12. Reubi JC, Schar JC, Waser B, Wenger S, Heppeler A, Schmitt JS & Macke HR. Affinity profiles for human somatostatin receptor subtypes SST1–SST5 of somatostatin radiotracers selected for scintigraphic and radiotherapeutic use. European Journal of Nuclear Medicine 2000 27 273–282.[CrossRef][ISI][Medline]

    13. Papotti M, Croce S, Bello M, Bongiovanni M, Allia E, Schindler M & Bussolati G. Expression of somatostatin receptor types 2, 3 and 5 in biopsies and surgical specimens of human lung tumours. Correlation with preoperative octreotide scintigraphy. Virchows Archiv 2001 439 787–797.[ISI][Medline]

    14. Hofland LJ & Lamberts SW. The pathophysiological consequences of somatostatin receptor internalization and resistance. Endocrine Reviews 2003 24 28–47.[Abstract/Free Full Text]

    15. Saveanu A, Gunz G, Dufour H, Caron P, Fina F, Ouafik L, Culler MD, Moreau JP, Enjalbert A & Jaquet P. Bim-23244, a somatostatin receptor subtype 2-and 5-selective analog with enhanced efficacy in suppressing growth hormone (GH) from octreotide-resistant human GH-secreting adenomas. Journal of Clinical Endocrinology and Metabolism 2001 86 140–145.[Abstract/Free Full Text]

    16. Van Der Hoek J, Van Der Lelija J, Feelders RA, De Herder WW, Uitterlinden P, Poon KW, Boerlin V, Lewis I, Krahnke T, Hofland LJ & Lamberts SW. The somatostatin analogue SOM230, compared with octreotide, induces differential effects in several metabolic pathways in acromegalic patients. Clinical Endocrinology (Oxf) 2005 63 176–184.[CrossRef][Medline]

    17. Van Der Hoek J, De Herder WW, Feelders RA, Van Der Lely AJ, Uitterlinden P, Boerlin V, Bruns C, Poon KW, Lewis I, Weckbecker G, Krahnke T, Hofland LJ & Lamberts SW. A single-dose comparison of the acute effects between the new somatostatin analog SOM230 and octreotide in acromegalic patients. Journal of Clinical Endocrinology and Metabolism 2004 89 638–645.[Abstract/Free Full Text]

    18. Saveanu A, Lavaque E, Gunz G, Barlier A, Kim S, Taylor JE, Culler MD, Enjalbert A & Jaquet P. Demonstration of enhanced potency of a chimeric somatostatin-dopamine molecule, BIM-23A387, in suppressing growth hormone and prolactin secretion from human pituitary somatotroph adenoma cells. Journal of Clinical Endocrinology and Metabolism 2002 87 5545–5552.[Abstract/Free Full Text]

    19. Jaquet P, Saveanu A & Barlier A. New SRIF analogs in the control of human pituitary adenomas: perspectives. Journal of Endocrinological Investigation 2005 28 14–18.[Medline]

    20. Lemmer K, Ahnert-Hilger G, Hopfner M, Hoegerle S, Faiss S, Grabowski P, Jockers-Scherubl M, Riecken EO, Zeitz M & Scherubl H. Expression ofdopamine receptors and transporter inneuroendocrine gastrointestinal tumor cells. Life Science 2002 71 667–678.[CrossRef][ISI][Medline]

    21. Solcia E & Klöppel G. Histological typing of endocrine tumours. In Histological Typing of Endocrine Tumours (International Classification of Tumours), EdsEdE Solcia, G Klöppel & Lh Sobin, Berlin: Springer, 2000.

    22. Turley H, Scott PA, Watts VM, Bicknell R, Harris aL & Gatter KC. Expression of VEGF in routinely fixed material using a new monoclonal antibody VG1. Journal of Pathology 1998 186 313–318.[CrossRef][ISI][Medline]

    23. Couvelard A, O’toole D, Turley H, Leek R, Sauvanet A, Degott C, Ruszniewski P, Belghiti J, Harris AL, Gatter K & Pezzella F. Microvascular density and hypoxia-inducible factor pathway in pancreatic endocrine tumours: negative correlation of micro-vascular density and VEGF expression with tumour progression. British Journal of Cancer 2005 92 94–101.[CrossRef][ISI][Medline]

    24. Jaquet P, Saveanu A, Gunz G, Fina F, Zamora AJ, Grino M, Culler MD, Moreau JP, Enjalbert A & Ouafik LH. Human somatostatin receptor subtypes in acromegaly: distinct patterns of messenger ribonucleic acid expression and hormone suppression identify different tumoral phenotypes. Journal of Clinical Endocrinology and Metabolism 2000 85 781–792.[Abstract/Free Full Text]

    25. Mezey E, Eisenhofer G, Hansson S, Harta G, Hoffman BJ, Gallatz K, Palkovits M & Hunyady B. Non-neuronal dopamine in the gastrointestinal system. Clinical and Experimental Pharmacology & Physiology. Supplement 1999 26 S14–S22.

    26. Jaquet P, Gunz G, Saveanu A, Dufour H, Taylor J, Dong J, Kim S, Moreau JP, Enjalbert A & Culler MD. Efficacy of chimeric molecules directed towards multiple somatostatin and dopamine receptors on inhibition of GH and prolactin secretion from GH-secreting pituitary adenomas classified as partially responsive to somatostatin analog therapy. European Journal of Endocrinology 2005 153 135–141.[Abstract/Free Full Text]

    27. Ferone D, Arvigo M, Semino C, Jaquet P, Saveanu A, Taylor JE, Moreau JP, Culler MD, Albertelli M, Minuto F & Barreca A. Somatostatin and dopamine receptor expression in lung carcinoma cells and effects of chimeric somatostatin-dopamine molecules on cell proliferation. American Journal of Physiology, Endocrinology and Metabolism 2005 289 E1044–E1050.[Abstract/Free Full Text]

    28. Hofland LJ, Lamberts SW, Van Hagen PM, Reubi JC, Schaeffer J, Waaijers M, Van Koetsveld PM, Srinivasan A, Krenning EP & Breeman WA. Crucial role for somatostatin receptor subtype 2 in determining the uptake of [111In-DTPA-D-Phe1]octreotide in somatostatin receptor-positive organs. Journal of Nuclear Medicine 2003 44 1315–1321.[Abstract/Free Full Text]

    29. Kulaksiz H, Eissele R, Rossler D, Schulz S, Hollt V, Cetin Y & Arnold R. Identification of somatostatin receptor subtypes 1, 2A, 3, and 5 in neuroendocrine tumours with subtype specific antibodies. Gut 2002 50 52–60.[Abstract/Free Full Text]

    30. Krenning EP, Kwekkeboom DJ, Bakker WH, Breeman WA, Kooij PP, Oei HY, Van Hagen M, Postema PT, De Jong M, Reubi JC, Visser TJ, Reijs AEM, Hofland LJ, Koper JW & Lamberts SWJ. Somatostatin receptor scintigraphy with [111In-DTPA-D-Phe1]-and [123I-Tyr3]-octreotide: the Rotterdam experience with more than 1000 patients. European Journal of Nuclear Medicine 1993 20 716–731.[ISI][Medline]

    31. Kwekkeboom DJ, Teunissen JJ, Bakker WH, Kooij PP, De Herder WW, Feelders RA, Van Eijck CH, Esser JP, Kam BL & Krenning EP. Radiolabeled somatostatin analog [177Lu-DOTA0,-Tyr3]octreotate in patients with endocrine gastroenteropancreatic tumors. Journal of Clinical Oncology 2005 23 2754–2762.[Abstract/Free Full Text]

    32. Plockinger U, Reichel M, Fett U, Saeger W & Quabbe HJ. Preoperative octreotide treatment of growth hormone-secreting and clinically nonfunctioning pituitary macroadenomas: effect on tumor volume and lack of correlation with immunohistochemistry and somatostatin receptor scintigraphy. Journal of Clinical Endocrinology and Metabolism 1994 79 1416–1423.[Abstract]

    33. Nilsson O, Kolby L, Wangberg B, Wigander A, Billig H, William-Olsson L, Fjalling M, Forssell-Aronsson E & Ahlman H. Comparative studies on the expression of somatostatin receptor subtypes, outcome of octreotide scintigraphy and response to octreotide treatment in patients with carcinoid tumours. British Journal of Cancer 1998 77 632–637.[ISI][Medline]

    34. Ricci S, Antonuzzo A, Galli L, Ferdeghini M, Bodei L, Orlandini C & Conte PF. Octreotide acetate long-acting release in patients with metastatic neuroendocrine tumors pretreated with lanreotide. Annals of Oncology 2000 11 1127–1130.[Abstract/Free Full Text]

    35. Lebtahi R, Cadiot G, Sarda L, Daou D, Faraggi M, Petegnief Y, Mignon M & Le Guludec D. Clinical impact of somatostatin receptor scintigraphy in the management of patients with neuroendocrine gastroenteropancreatic tumors. Journal of Nuclear Medicine 1997 38 853–858.[Abstract/Free Full Text]

    36. John M, Meyerhof W, Richter D, Waser B, Schaer JC, Scherubl H, Boese-Landgraf J, Neuhaus P, Ziske C, Molling K, Riecken EO, Reubi JC & Wiedenmann B. Positive somatostatin receptor scintigraphy correlates with the presence of somatostatin receptor subtype 2. Gut 1996 38 33–39.[Abstract/Free Full Text]

    37. Barlier A, Pellegrini-Bouiller I, Gunz G, Zamora AJ, Jaquet P & Enjalbert A. Impact of gsp oncogene on the expression of genes coding for Gsalpha, Pit-1, Gi2alpha, and somatostatin receptor 2 in human somatotroph adenomas: involvement in octreotide sensitivity. Journal of Clinical Endocrinology and Metabolism 1999 84 2759–2765.[Abstract/Free Full Text]

    38. Leers MP, Hoop JG, Van Beers M, Van Rodijnen N, Pannebakker M & Nap M. Determination of threshold values for determining the size of the fraction of steroid hormone receptor-positive tumor cells in paraffin-embedded breast carcinomas. Cytometry. Part B, Clinical Cytometry 2005 64 43–52.

    39. Ogawa Y, Moriya T, Kato Y, Oguma M, Ikeda K, Takashima T, Nakata B, Ishikawa T & Hirakawa K. Immunohistochemical assessment for estrogen receptor and progesterone receptor status in breast cancer: analysis for a cut-off point as the predictor for endocrine therapy. Breast Cancer 2004 11 267–275.[Medline]

    40. Olias G, Viollet C, Kusserow H, Epelbaum J & Meyerhof W. Regulation and function of somatostatin receptors. Journal of Neurochemistry 2004 89 1057–1091.[CrossRef][ISI][Medline]

    41. Albini A, Florio T, Giunciuglio D, Masiello L, Carlone S, Corsaro A, Thellung S, Cai T, Noonan DM & Schettini G. Somatostatin controls Kaposi’s sarcoma tumor growth through inhibition of angiogenesis. FASEB Journal 1999 13 647–655.[Abstract/Free Full Text]

    42. Florio T, Morini M, Villa V, Arena S, Corsaro A, Thellung S, Culler MD, Pfeffer U, Noonan DM, Schettini G & Albini A. Somatostatin inhibits tumor angiogenesis and growth via somatostatin receptor-3-mediated regulation of endothelial nitric oxide synthase and mitogen-activated protein kinase activities. Endocrinology 2003 144 1574–1584.[Abstract/Free Full Text]

    43. Hall GH, Turnbull LW, Bedford K, Richmond I, Helboe L & Atkin SL. Neuropilin-1 and VEGF correlate with somatostatin expression and microvessel density in ovarian tumours. International Journal of Oncology 2005 27 1283–1288.[ISI][Medline]

    44. De Sa SV, Correa-Giannella ML, Machado MC, De Souza JJ, Pereira MA, Patzina RA, Siqueira SA, Machado MC & Giannella-Neto D. Somatostatin receptor subtype 5 (SSTR5) mRNA expression is related to histopathological features of cell proliferation in insulinomas. Endocrine Related Cancer 2006 13 69–78.[Abstract/Free Full Text]

    45. Arena S, Barbieri F, Thellung S, Pirani P, Corsaro A, Villa V, Dadati P, Dorcaratto A, Lapertosa G, Ravetti JL, Spaziante R, Schettini G & Florio T. Expression of somatostatin receptor mRNA in human meningiomas and their implication in in vitro antiproliferative activity. Journal of Neuro Oncology 2004 66 155–166.[Medline]

    46. Mawrin C, Schulz S, Pauli SU, Treuheit T, Diete S, Dietzmann K, Firsching R, Schulz S & Hollt V. Differential expression of sst1, sst2A, and sst3 somatostatin receptor proteins in low-grade and high-grade astrocytomas. Journal of Neuropathology and Experimental Neurology 2004 63 13–19.[ISI][Medline]

    47. Orlando C, Raggi CC, Bianchi S, Distante V, Simi L, Vezzosi V, Gelmini S, Pinzani P, Smith MC, Buonamano A, Lazzeri E, Pazzagli M, Cataliotti L, Maggi M & Serio M. Measurement of somatostatin receptor subtype 2 mRNA in breast cancer and corresponding normal tissue. Endocrine Related Cancer 2004 11 323–332.[Abstract]

    48. Adams RL, Adams IP, Lindow SW & Atkin SL. Inhibition of endothelial proliferation by the somatostatin analogue SOM230. Clinical Endocrinology (Oxf) 2004 61 431–436.[CrossRef][Medline]

Received 21 July 2006
Accepted 2 October 2006




This article has been cited by other articles:


Home page
 Eur J EndocrinolHome page
R. Pivonello, D. Ferone, G. Lombardi, A. Colao, S. W J Lamberts, and L. J Hofland
Novel insights in dopamine receptor physiology
Eur. J. Endocrinol., April 1, 2007; 156(suppl_1): S13 - S21.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
D. Ferone, A. Saveanu, M. D Culler, M. Arvigo, A. Rebora, F. Gatto, F. Minuto, and P. Jaquet
Novel chimeric somatostatin analogs: facts and perspectives
Eur. J. Endocrinol., April 1, 2007; 156(suppl_1): S23 - S28.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Toole, D.
Right arrow Articles by Barlier, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Toole, D.
Right arrow Articles by Barlier, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS