Eur J Endocrinol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


DOI: 10.1530/eje.1.01860
European Journal of Endocrinology, Vol 152, Issue 3, 419-425
Copyright © 2005 by European Society of Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferlin, A.
Right arrow Articles by Foresta, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferlin, A.
Right arrow Articles by Foresta, C.

CLINICAL STUDY

Androgen receptor gene CAG and GGC repeat lengths in cryptorchidism

Alberto Ferlin1, Andrea Garolla1, Andrea Bettella1, Lucia Bartoloni1, Cinzia Vinanzi1, Alberto Roverato2 and Carlo Foresta1

1 University of Padova, Department of Histology, Microbiology, and Medical Biotechnologies, Centre for Male Gamete Cryopreservation, 35121 Padova, Italy, 2 University of Modena and Reggio Emilia, Department of Social, Cognitive and Quantitative Sciences, 42100 Reggio Emilia, Italy

(Correspondence should be addressed to C Foresta; Email: carlo.foresta{at}unipd.it)


    Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Objective: Cryptorchidism is the most common congenital birth defect in male children, and accumulating evidence suggests that genetic abnormalities may be associated with it. The androgen receptor has two polymorphic sites in exon 1, with different numbers of CAG and GGC repeats, resulting in variable lengths of polyglutamine and polyglycine stretches. Longer CAG repeats result in a reduced androgen receptor transcriptional activity, but the role of the GGC triplets is less clear. In this study we analysed CAG and GGC repeat lengths in men with a history of cryptorchidism, associated or not with impairment of sperm production, in comparison with normal fertile subjects.

Methods: We analysed CAG and GGC repeat lengths in a group of 105 ex-cryptorchid men in comparison with 115 fertile non-cryptorchid men.

Results: No difference was found between patients and controls in the mean and median values, and in distribution of CAG and GGC, when considered separately. However, the analysis of the joint distribution of CAG and GGC showed that some combinations are significantly more frequent in men with bilateral cryptorchidism (who frequently presented severe testiculopathies), in a manner similar to that found in idiopathic infertile subjects.

Conclusions: Although further studies are needed to elucidate the possible role of specific CAG/GGC combinations as a causative factor, these data suggest a possible association between androgen receptor gene polymorphisms and cryptorchidism.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Cryptorchidism is the failure of the testes to descend into the scrotal sacs; it is the most common congenital birth defect in boys. Although its frequency may vary among different countries (1), a figure of 2–4% in full-term male births is generally accepted (2). The aetiology of cryptorchidism remains unknown for a large proportion of cases, reflecting our limited knowledge of the mechanisms regulating testicular descent from abdomen to scrotum during embryonic development. A growing body of evidence suggests that genetic abnormalities may be associated with cryptorchidism (3), such as mutations in the INSL3/LGR8 hormonal system (414). Mutations in the androgen receptor (AR) gene, causing the androgen insensitivity syndrome, are known to be associated with variable development of the Wolffian duct and with micropenis, hypospadia and cryptorchidism (15, 16). However, screening for mutations in the AR gene in patients with isolated cryptorchidism failed to find any abnormality (17, 18), even if clear conclusions cannot be drawn from the limited number of subjects studied. Nevertheless, androgens, together with Mullerian inhibiting substance (MIS) and INSL3, are thought to be important in testicular descent, inducing the involution of the cranial suspensory ligament and the second migration step from the groin to the scrotum (trans-inguinal descent) (3). In fact, the critical role of androgens in testicular descent is supported by numerous clinical and animal evidence. The AR is a member of the steroid/nuclear receptor superfamily of ligand-activated transactivation factors, and it is encoded by a gene located on chromosome Xq11-12 (19). The gene exhibits two polymorphic sites in exon 1, characterized by different numbers of CAG and GGC repeats, resulting in variable lengths of polyglutamine and polyglycine stretches in the N-terminal region of the AR protein. Longer CAG repeats result in reduced AR transcriptional activity (20, 21), and there is evidence that an inverse correlation between CAG number and androgenicity exists. Consistent with this, expansion of the tract to >40 CAG repeats results in Kennedy’s syndrome, a rare motoneuron disorder also characterized by low masculinization, testicular atrophy, reduced sperm production and infertility (22, 23). However, cryptorchidism is not a major feature of Kennedy’s syndrome; therefore, the role of CAG expansion in cryptorchidism is not clear. On the other hand, shorter AR polyglutamine tracts have been associated with increased prostate cancer risk (2430), but this is still controversial. Although polymorphisms in CAG tract length correlate with sperm concentration in normal men (31), numerous studies examining CAG repeats in infertile men have reported conflicting results only in part justifiable by ethnicity, some (3238) showing no expansion, and others (3946) reporting increased length (but still in the normal range) with respect to fertile control men. To the best of our knowledge, only two studies have examined the CAG repeat length in men with cryptorchidism (47, 48), and they found no difference with respect to controls. The functional consequences of variations in the GGC repeat are even less clear, and epidemiological investigations of the association between the number of GGC repeats and prostate cancer risk (25, 27, 4951) or male infertility (38, 39, 52) produced inconsistent results. However, we have recently shown that, instead of the crude number of CAG or GGC triplets examined separately, the distribution of particular CAG/GGC combinations is significantly different between infertile men and controls (38), although these data should be further confirmed. In this study we analysed CAG and GGC repeat lengths in men with a history of cryptorchidism, associated or not with impairment of sperm production, in comparison with normal fertile subjects.


    Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Subjects

Patients and controls were prospectively recruited for this study with the approval of the hospital ethics committee, and informed consent was obtained from each subject. Among adult subjects referred to our centre for semen analysis, we recruited 105 men who were orchidopexied in childhood and who presented no other obvious causes of testicular damage. Men who reported spontaneous descent of the testes were excluded. The subjects were aged 23–42, and age at orchidopexied varied from 1 to 12 years. The precise location of the testes at the time of orchidopexy could not be determined in all cases, even if the majority of them were in the inguinal region. A complete medical history and a physical examination were undertaken. Semen analysis was repeated at least twice and was performed according to WHO guidelines (53). When semen analysis repeatedly revealed azoospermia (absence of sperm) or oligozoospermia with sperm concentrations of <5 x 106/ml, bilateral testicular fine-needle aspiration cytology (FNAC) (54) was performed. In all subjects, we had ultrasound examination of the testes (for testis morphology and volume) and plasma determination of follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin and testosterone concentrations. Exclusion of known causes of male infertility was done by careful history (excluding, for example, varicocele, orchitis and testicular trauma), sperm antibody determination, endocrine profile (excluding, for example, hypogonadotrophic hypogonadism and hyperprolactinaemia), karyotype analysis, Y chromosome microdeletion analysis (5557), cystic fibrosis transmembrane regulator gene mutation analysis, and INSL3 and LGR8 gene mutation analysis (13). Furthermore, AR gene mutations were excluded by PCR and direct sequencing, using a set of 11 oligonucleotide primers covering exons 1–8 (58). Ex-cryptorchid men were classified by type of cryptorchidism (bilateral versus unilateral) and presence or absence of a history of infertility with spermatogenic defect, as evaluated by semen and testicular cytological parameters. Therefore, of the 50 subjects with bilateral cryptorchidism, 40 had spermatogenic damage (sperm count of <20 x 106/ml) with infertility, and 10 had normozoospermia. Of the 55 subjects with unilateral cryptorchidism, 33 had spermatogenic damage with infertility, and 22 had normozoospermia. A total of 115 men with proven fertility and normozoospermia, without history of cryptorchidism, and recruited from men whose wives were in the first trimester of pregnancy, served as controls. All patients and controls were of Caucasian origin and came from different Italian regions.

Determination of the CAG and GGC repeat number

The number of CAG and GGC triplets was determined as previously reported (38). Genomic DNA was extracted from peripheral blood leucocytes with a DNA isolation kit (Roche, Milan, Italy). The AR exon 1 was amplified from genomic DNA in two different PCR reactions, giving overlapping amplicons. Both reactions were performed under the same conditions (standard conditions with 8% dimethylsulphoxide) and with the same cycle (94 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, repeated 37 times). The CAG repeat is contained in the amplicon produced with the primers A0 GTGGTTGCTC-CCGCAAGTTTCC and A5 GCTCCCACTTCCTCCAAGGA-CAATTA. It is sequenced with the primer A2 GCTGTGAAGGTTGCTGTTCCTC, using standard conditions for automated sequencing. The GGC repeat is amplified with the primers A3n CAGCAAGAGACTAGC-CCCAG and A10 CCAGAACACAGAGTGACTCTGCC, and it is sequenced with the primer A8 GGACTGGGATA-GGGCACTCTGCTCAACC. Primers A2, A5, A8 and A10 are from Lubahn et al. (58), whereas we designed the new primers A0 and A3n. Sequence analyses were performed with the gap4 software of the Staden package (59), which is available at the UK Human Genome Mapping Project Web page (www.hgmp.mrc.ac.uk/).

Statistical analysis

Differences in CAG and GGC mean repeat length were tested by Wilcoxon’s rank sum test. Differences among frequencies were calculated with both the chi-square test and Fisher’s exact test. Relative risks and the corresponding 95% confidence intervals were calculated on the basis of the asymptotic normal distribution of these quantities. Fisher’s exact test was used to analyse independence in two-way contingency tables. P < 0.05 was considered statistically significant. Computations were performed with the open-source statistical software ‘R’.


    Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Overall, the mean number of CAG and GGC repeats in exon 1 of the AR gene was 21.6±3.3 (range 9–31) and 17.0±1.7 (range 8–21) respectively, in proven fertile control men, and 21.8±2.9 (range 12–29) and 17.4±1.4 (range 10–21) in cryptorchid men (Table 1Go). These differences were not statistically significant, and no difference was evident when comparing the median value of CAG and GGC number. The subgrouping of cryptorchid men in bilateral and unilateral forms, and in those with or without spermatogenic damage also showed no differences in terms of mean and median values of CAG and GGC repeat number with respect to controls (Table 1Go). The distribution of CAG and GGC allele frequencies (Fig. 1Go) was not different between cryptorchid men and controls. Although there was an apparent trend toward a shift to GGC=18 or GGC > 18 in men with cryptorchidism especially in the bilateral form, no significant difference was observed with respect to controls. Our previous work on AR triplet number (38) showed that some haplotypes (combination of CAG and GGC repeat number) could be associated with male infertility, suggesting that both CAG and GGC could modulate AR function. Therefore, we assume the joint distribution of CAG and GGC. As reported previously (38), for this analysis, the data were collected in two-way tables (Tables 2Go and 3Go) reporting frequencies for each CAG/GGC haplotype. CAG numbers of <20 and >24, corresponding to the first and third quartiles of the distribution for controls, were considered in single categories. In the GGC distribution, most of the observations belong to categories 17 and 18 (Fig. 1Go); therefore, we considered in a single category the GGC numbers under or equal to 16 and those over or equal to 19. Analysis of the percentages of the two-way tables showed that there were no differences between controls and cryptorchids considered as a whole. However, analysis in the different subgroups of cryptorchid men showed a difference between controls and men with bilateral cryptorchidism concerning the cell CAG = 21/GGC = 18 (prevalence of 16.0% in bilateral cryptorchid men versus 5.2% in controls; P < 0.05), and those corresponding to CAG ≥ 21/GGC ≥ 18 (prevalence of 38.0% in bilateral cryptorchid men versus 20.9% in controls; P < 0.05). The calculated relative risks and the corresponding confidence intervals of these combinations are shown in Table 4Go.


View this table:
[in this window]
[in a new window]
 
Table 1 CAG and GGC values in cryptochid men and controls. All data not statistically significant (P > 0.05).
 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 1 Distribution of CAG and GGC allele frequencies.

 

View this table:
[in this window]
[in a new window]
 
Table 2 Joint distribution of CAG and GGC percentages (number in parenthesis) for the 115 fertile control men. P values with respect to that found in cryptorchid men (Table 3Go) are reported in Table 4Go.
 

View this table:
[in this window]
[in a new window]
 
Table 3 Joint distribution of CAG and GGC percentages (number in parenthesis) for the 105 cryptorchid men. P values with respect to that found in controls (Table 2Go) are reported in Table 4Go.
 

View this table:
[in this window]
[in a new window]
 
Table 4 Analysis of distribution of combinations CAG = 21/GGC = 18, and CAG ≥ 21/GGC ≥ 18 in cryptorchid men and controls with the associated relative risks (RR) and 95% confidence intervals (CI).
 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Accumulating evidence suggests that a genetic component may be associated with cryptorchidism. However, a direct cause–effect relationship between specific genetic alterations and cryptorchidism is not evident in many cases. For example, Y chromosome long-arm microdeletions removing one or more ‘azoospermia factors’ (AZFa, b and c) (60) may be found in cryptorchid men (57, 61, 62). In these cases, AZF deletions seem not to be implicated in the pathogenesis of cryptorchidism itself; rather, they are responsible only for the severe spermatogenic damage that is frequently associated with this condition. On the other hand, the numerous data from animal models suggesting a role for some genes in testicular descent and cryptorchidism have not been confirmed in humans, as we recently showed for the CgRP system (63). Other genetic abnormalities, such as those involving MIS or HOXA-10, may lead to cryptorchidism (3), but their clinical importance is not so evident (64). Therefore, mutations in INSL3/LGR8 or AR genes may be considered the only genetic factors known to be responsible for human cryptorchidism with specific frequency. The role of CAG triplets in exon 1 of the AR in cryptorchidism is less clear, and the combined effect of CAG and GGC repeat numbers is completely unknown. In this study we analysed for the first time both CAG and GGC triplets in a group of men with a history of cryptorchidism, with or without associated spermatogenic impairment, and found that there is no difference with respect to normozoospermic fertile controls when these variables are analysed separately. However, we found significant differences when the joint distribution of CAG and GGC and the specific combinations of CAG and GGC were analysed. In particular, men with a history of bilateral cryptorchidism more frequently presented the combination CAG = 21/GGC = 18 and CAG ≥ 21/GGC ≥ 18. These findings need to be considered in the light of our recent report on CAG and GGC triplet analysis in idiopathic infertile males (38). In fact, in that study, we found that the same two combinations were significantly more frequent in idiopathic infertile patients with respect to controls.

First of all, the present study confirms the findings of Sasagawa et al. (48) in Japanese subjects regarding the absence of an association between CAG length and cryptorchidism. For the first time, we also analysed the GGC polyglycine tract length and found that it is not related to cryptorchidism. Furthermore, our data suggest that CAG and GGC number is not different between normal, idiopathic infertile, and cryptorchid men (38). Secondly, the finding that two CAG/GGC combinations seem to increase susceptibility to cryptorchidism, particularly of the bilateral form, could be interpreted in different ways. In fact, although we found a difference between the bilateral cryptorchid men and the controls, these could be chance findings, and no conclusion regarding the biological importance of these combinations can be drawn. We have also to consider that the great majority of bilateral cases (40/50, 80%) did actually present a spermatogenetic impairment, and idiopathic severely infertile men showed the same higher frequency of these particular combinations (38). Therefore, further analyses on a larger group of cryptorchid men without spermatogenic damage should be performed to clarify this aspect. For example, one hypothesis is that the presence of these combinations causes a testicular alteration whose consequences are impairment of spermatogenesis (germ cell damage) and cryptorchidism (altered testicular responses to mechanisms regulating testicular descent), in a manner similar to that proposed for Y chromosome microdeletions (57, 61). Another hypothesis is that these two CAG/GGC combinations directly cause the cryptorchid phenotype by preventing normal testicular descent. The finding of this association only in bilateral cases seems to support this hypothesis, since unilateral cases are less likely to be explained by genetic alterations. Therefore, although cryptorchidism and infertility may frequently be associated, they could also represent two distinct clinical phenotypes of the same genetic alteration. However, again in these cases, a larger number of subjects are needed to verify this hypothesis. We have also to keep in mind that cryptorchidism is a heterogeneous and variable condition, and hence is likely to be multifactorial (3). Strict clinical and pathological criteria are therefore important when analysing putative genetic aetiologies. Even if the association between CAG/GGC haplotypes and the clinical phenotype is confirmed, the mechanism by which they cause cryptorchidism or spermatogenic impairment can only be speculative. We can hypothesize that different CAG/GGC combinations may modulate AR function, and that the combinations CAG = 21/GGC = 18 and CAG ≥ 21/GGC ≥ 18 could determine a reduction in the transcriptional activity of the receptor. However, CAG = 21/GGC = 18 is one of the most common alleles among Caucasians, and it is the fourth most frequent haplotype found in our fertile control group. Therefore, its role as a causative factor of cryptorchidism is less understandable. In vitro transactivation studies with the AR constructed with different CAG/GGC combinations and expression analyses are under way to verify this hypothesis and clarify the molecular mechanisms involved in the modulation of AR activity. In our series, the precise location of the cryptorchid testes at the time of orchidopexy could not be recorded in all cases, even if the majority of them were in the inguinal region. A more detailed analysis of CAG and GGC lengths in relation to the severity of cryptorchidism and a prospective study in childhood would be interesting. In conclusion, we found no association between CAG or GGC repeat number in the AR gene and cryptorchidism. Taken together with previous studies (34), this suggests that expansion of these tracts is unlikely to constitute a major cause of cryptorchidism. The possible relationship of specific CAG/GGC haplotypes to cryptorchidism, as well as to idiopathic male infertility, seems to suggest that some combinations of CAG and GGC may modulate AR function, but this needs to be verified in other studies.


    Acknowledgements
 
The financial support of the Italian Ministry of Instruction, University and Research (MIUR) (2003 grant) to C F and of the University of Padova to A F is gratefully acknowledged.


    References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

    1. Boisen KA, Kaleva M, Main KM, Virtanen HE, Haavisto AM, Schmidt IM, Chellakooty M, Damgaard IN, Mau C, Reunanen M, Skakkebaek NE & Toppari J. Difference in prevalence of congenital cryptorchidism in infants between two Nordic countries. Lancet 2004 363 1264–1269.[CrossRef][Web of Science][Medline]

    2. Barthold JS & Gonzalez R. The epidemiology of congenital cryptorchidism, testicular ascent and orchiopexy. Journal of Urology 2003 170 2396–2401.[CrossRef][Web of Science][Medline]

    3. Ivell R & Hartung S. The molecular basis of cryptorchidism. Molecular Human Reproduction 2003 9 175–181.[Abstract/Free Full Text]

    4. Koskimies P, Virtanen H, Lindstrom M, Kaleva M, Poutanen M, Huhtaniemi I & Toppari J. A common polymorphism in the human relaxin-like factor (RLF) gene: no relationship with cryptorchidism. Pediatric Research 2000 47 538–541.[Web of Science][Medline]

    5. Krausz C, Quintana-Murci L, Fellous M, Siffroi JP & McElreavey K. Absence of mutations involving the INSL3 gene in human idiopathic cryptorchidism. Molecular Human Reproduction 2000 6 298–302.[Abstract/Free Full Text]

    6. Tomboc M, Lee PA, Mitwally MF, Schneck FX, Bellinger M & Witchel SF. Insulin-like 3/relaxin-like factor gene mutations are associated with cryptorchidism. Journal of Clinical Endocrinology and Metabolism 2000 85 4013–4018.[Abstract/Free Full Text]

    7. Lim HN, Raipertde Meyts E, Skakkebaek NE, Hawkins JR & Hughes IA. Genetic analysis of the INSL3 gene in patients with maldescent of the testis. European Journal of Endocrinology 2001 144 129–137.[Abstract]

    8. Marin P, Ferlin A, Moro E, Rossi A, Bartoloni L, Rossato M & Foresta C. Novel insulin-like 3 (INSL3) gene mutation associated with human cryptorchidism. American Journal of Medical Genetics 2001 103 348–349.[CrossRef][Web of Science][Medline]

    9. Takahashi I, Takahashi T, Komatsu M, Matsuda J & Takada G. Ala/Thr60 variant of the Leydig insulin-like hormone is not associated with cryptorchidism in the Japanese population. Pediatrics International 2001 43 256–258.[CrossRef][Web of Science][Medline]

    10. Baker LA, Nef S, Nguyen MT, Stapleton R, Nordenskjold A, Pohl H & Parada LF. The insulin-3 gene: lack of a genetic basis for human cryptorchidism. Journal of Urology 2002 167 2534–2537.[CrossRef][Web of Science][Medline]

    11. Gorlov IP, Kamat A, Bogatcheva NV, Jones E, Lamb DJ, Truong A, Bishop CE, McElreavey K & Agoulnik AI. Mutations of the GREAT gene cause cryptorchidism. Human Molecular Genetics 2002 11 2309–2318.[Abstract/Free Full Text]

    12. Canto P, Escudero I, Soderlund D, Nishimura E, Carranza-Lira S, Gutierrez J, Nava A & Mendez JP. A novel mutation of the insulin-like 3 gene in patients with cryptorchidism. Journal of Human Genetics 2003 48 86–90.[CrossRef][Web of Science][Medline]

    13. Ferlin A, Simonato M, Bartoloni L, Rizzo G, Bettella A, Dottorini T, Dallapiccola B & Foresta C. The INSL3-LGR8/GREAT ligand-receptor pair in human cryptorchidism. Journal of Clinical Endocrinology and Metabolism 2003 88 4273–4279.[Abstract/Free Full Text]

    14. Foresta C & Ferlin A. Role of INSL3 and LGR8 in cryptorchidism and testicular functions. Reproduction Biomedicine Online 2004 9 294–298.

    15. Brinkmann AO. Molecular basis of androgen insensitivity. Molecular and Cellular Endocrinology 2001 179 105–109.[CrossRef][Web of Science][Medline]

    16. Sultan C, Paris F, Terouanne B, Balaguer P, Georget V, Poujol N, Jeandel C, Lumbroso S & Nicolas JC. Disorders linked to insufficient androgen action in male children. Human Reproduction Update 2001 7 314–322.[Abstract/Free Full Text]

    17. Wiener JS, Marcelli M, Gonzales ET Jr, Roth DR & Lamb DJ. Androgen receptor gene alterations are not associated with isolated cryptorchidism. Journal of Urology 1998 160 863–865.[CrossRef][Web of Science][Medline]

    18. Suzuki Y, Sasagawa I, Ashida J, Nakada T, Muroya K & Ogata T. Screening for mutations of the androgen receptor gene in patients with isolated cryptorchidism. Fertility and Sterility 2001 76 834–836.[CrossRef][Web of Science][Medline]

    19. Lubahn DB, Joseph DR, Sullivan PM, Willard HF, French FS & Wilson EM. Cloning of human androgen receptor complementary DNA and localization to the X chromosome. Science 1988 240 327–330.[Abstract/Free Full Text]

    20. Chamberlain NL, Driver ED & Miesfeld RL. The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function. Nucleic Acids Research 1994 22 3181–3186.[Abstract/Free Full Text]

    21. Choong CS, Kemppainen JA, Zhou ZX & Wilson EM. Reduced androgen receptor gene expression with first exon CAG repeat expansion. Molecular Endocrinology 1996 10 1527–1535.[Abstract/Free Full Text]

    22. Brooks BP & Fischbeck KH. Spinal and bulbar muscular atrophy: a trinucleotide-repeat expansion neurodegenerative disease. Trends in Neurosciences 1995 18 459–461.[CrossRef][Web of Science][Medline]

    23. Kazemi-Esfarjani P, Trifiro MA & Pinsky L. Evidence for a repressive function of the long polyglutamine tract in the human androgen receptor: possible pathogenetic relevance for the (CAG)n-expanded neuronopathies. Human Molecular Genetics 1995 4 523–527.[Abstract/Free Full Text]

    24. Giovannucci E, Stampfer MJ, Krithivas K, Brown M, Dahl D, Brufsky A, Talcott J, Hennekens CH & Kantoff PW. The CAG repeat within the androgen receptor gene and its relationship to prostate cancer. PNAS 1997 94 3320–3323.[Abstract/Free Full Text]

    25. Hakimi JM, Schoenberg MP, Rondinelli RH, Piantadosi S & Barrack ER. Androgen receptor variants with short glutamine or glycine repeats may identify unique subpopulations of men with prostate cancer. Clinical Cancer Research 1997 3 1599–1608.[Abstract]

    26. Ingles SA, Ross RK, Yu MC, Irvine RA, La Pera G, Haile RW & Coetzee GA. Association of prostate cancer risk with genetic polymorphisms in vitamin D receptor and androgen receptor. Journal of the National Cancer Institute 1997 89 166–170.[Abstract/Free Full Text]

    27. Stanford JL, Just JJ, Gibbs M, Wicklund KG, Neal CL, Blumenstein BA & Ostrander EA. Polymorphic repeats in the androgen receptor gene: molecular markers of prostate cancer risk. Cancer Research 1997 57 1194–1198.[Abstract/Free Full Text]

    28. Kantoff P, Giovannucci E & Brown M. The androgen receptor CAG repeat polymorphism and its relationship to prostate cancer. Biochimica et Biophysica Acta 1998 1378 C1–C5.[Medline]

    29. Platz EA, Giovannucci E, Dahl DM, Krithivas K, Hennekens CH, Brown M, Stampfer MJ & Kantoff PW. The androgen receptor gene GGN microsatellite and prostate cancer risk. Cancer Epidemiology Biomarkers and Prevention 1998 7 379–384.[Abstract/Free Full Text]

    30. Hsing AW, Gao YT, Wu G, Wang X, Deng J, Chen YL, Sesterhenn IA, Mostofi FK, Benichou J & Chang C. Polymorphic CAG and GGN repeat lengths in the androgen receptor gene and prostate cancer risk: a population-based case-control study in China. Cancer Research 2000 60 5111–5116.[Abstract/Free Full Text]

    31. von Eckardstein S, Syska A, Gromoll J, Kamischke A, Simoni M & Nieschlag E. Inverse correlation between sperm concentration and number of androgen receptor CAG repeats in normal men. Journal of Clinical Endocrinology and Metabolism 2001 86 2585–2590.[Abstract/Free Full Text]

    32. Giwercman YL, Xu C, Arver S, Pousette A & Reneland R. No association between the androgen receptor gene CAG repeat and impaired sperm production in Swedish men. Clinical Genetics 1998 54 435–436.[Web of Science][Medline]

    33. Dadze S, Wieland C, Jakubiczka S, Funke K, Schroder E, Royer-Pokora B, Willers R & Wieacker PF. The size of the CAG repeat in exon 1 of the androgen receptor gene shows no significant relationship to impaired spermatogenesis in an infertile Caucasoid sample of German origin. Molecular Human Reproduction 2000 6 207–214.[Abstract/Free Full Text]

    34. Sasagawa I, Suzuki Y, Ashida J, Nakada T, Muroya K & Ogata T. CAG repeat length analysis and mutation screening of the androgen receptor gene in Japanese men with idiopathic azoospermia. Journal of Andrology 2001 22 804–808.[Abstract]

    35. Van Golde R, Van Houwelingen K, Kiemeney L, Kremer J, Tuerlings J, Schalken J & Meuleman E. Is increased CAG repeat length in the androgen receptor gene a risk factor for male sub-fertility? Journal of Urology 2002 167 621–623.[CrossRef][Web of Science][Medline]

    36. Rajpert-De Meyts E, Leffers H, Petersen JH, Andersen AG, Carlsen E, Jorgensen N & Skakkebaek NE. CAG repeat length in androgen-receptor gene and reproductive variables in fertile and infertile men. Lancet 2002 359 44–46.[CrossRef][Web of Science][Medline]

    37. Lund A, Tapanainen JS, Lahdetie J, Savontaus ML & Aittomaki K. Long CAG repeats in the AR gene are not associated with infertility in Finnish males. Acta Obstetricia et Gynecologica Scandinavica 2003 82 162–166.[CrossRef][Web of Science][Medline]

    38. Ferlin A, Bartoloni L, Rizzo G, Roverato A, Garolla A & Foresta C. Androgen receptor gene CAG and GGC repeat lengths in idiopathic male infertility. Molecular Human Reproduction 2004 10 417–421.[Abstract/Free Full Text]

    39. Tut TG, Ghadessy FJ, Trifiro MA, Pinsky L & Yong EL. Long poly-glutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility. Journal of Clinical Endocrinology and Metabolism 1997 82 3777–3782.[Abstract/Free Full Text]

    40. Dowsing AT, Yong EL, Clark M, McLachlan RI, de Kretser DM & Trounson AO. Linkage between male infertility and trinucleotide repeat expansion in the androgen-receptor gene. Lancet 1999 354 640–643.[CrossRef][Web of Science][Medline]

    41. Yoshida KI, Yano M, Chiba K, Honda M & Kitahara S. CAG repeat length in the androgen receptor gene is enhanced in patients with idiopathic azoospermia. Urology 1999 54 1078–1081.[CrossRef][Web of Science][Medline]

    42. Mifsud A, Sim CK, Boettger-Tong H, Moreira S, Lamb DJ, Lipshultz LI & Yong EL. Trinucleotide (CAG). repeat polymorphisms in the androgen receptor gene: molecular markers of risk for male infertility. Fertility and Sterility 2001 75 275–281.[CrossRef][Web of Science][Medline]

    43. Patrizio P, Leonard DG, Chen KL, Hernandez-Ayup S & Trounson AO. Larger trinucleotide repeat size in the androgen receptor gene of infertile men with extremely severe oligozoospermia. Journal of Andrology 2001 22 444–448.[Abstract]

    44. Wallerand H, Remy-Martin A, Chabannes E, Bermont L, Adessi GL & Bittard H. Relationship between expansion of the CAG repeat in exon 1 of the androgen receptor gene and idiopathic male infertility. Fertility and Sterility 2001 76 769–774.[CrossRef][Web of Science][Medline]

    45. Casella R, Maduro MR, Misfud A, Lipshultz LI, Yong EL & Lamb DJ. Androgen receptor gene polyglutamine length is associated with testicular histology in infertile patients. Journal of Urology 2003 169 224–227.[CrossRef][Web of Science][Medline]

    46. Mengual L, Oriola J, Ascaso C, Ballesca JL & Oliva R. An increased CAG repeat length in the androgen receptor gene in azoospermic ICSI candidates. Journal of Andrology 2003 24 279–284.[Abstract/Free Full Text]

    47. Lim HN, Nixon RM, Chen H, Hughes IA & Hawkins JR. Evidence that longer androgen receptor polyglutamine repeats are a causal factor for genital abnormalities. Journal of Clinical Endocrinology and Metabolism 2001 86 3207–3210.[Abstract/Free Full Text]

    48. Sasagawa I, Suzuki Y, Tateno T, Nakada T, Muroya K & Ogata T. CAG repeat length of the androgen receptor gene in Japanese males with cryptorchidism. Molecular Human Reproduction 2000 6 973–975.[Abstract/Free Full Text]

    49. Irvine RA, Yu MC, Ross RK & Coetzee GA. The CAG and GGC microsatellites of the androgen receptor gene are in linkage disequilibrium in men with prostate cancer. Cancer Research 1995 55 1937–1940.[Abstract/Free Full Text]

    50. Chang BL, Zheng SL, Hawkins GA, Isaacs SD, Wiley KE, Turner A, Carpten JD, Bleecker ER, Walsh PC, Trent JM, Meyers DA, Isaacs WB & Xu J. Polymorphic GGC repeats in the androgen receptor gene are associated with hereditary and sporadic prostate cancer risk. Human Genetics 2002 110 122–129.[CrossRef][Web of Science][Medline]

    51. Chen C, Lamharzi N, Weiss NS, Etzioni R, Dightman DA, Barnett M, DiTommaso D & Goodman G. Androgen receptor polymorphisms and the incidence of prostate cancer. Cancer Epidemiology Biomarkers and Prevention 2002 11 1033–1040.[Abstract/Free Full Text]

    52. Lundin KB, Giwercman A, Richthoff J, Abrahamsson PA & Giwercman YL. No association between mutations in the human androgen receptor GGN repeat and inter-sex conditions. Molecular Human Reproduction 2003 9 375–379.[Abstract/Free Full Text]

    53. World Health Organization. WHO Laboratory Manual for the Examination of Human Semen and Sperm-Cervical Mucus Interaction. Cambridge: Cambridge University Press, 1999.

    54. Foresta C, Varotto A & Scandellari C. Assessment of testicular cytology by fine needle aspiration as a diagnostic parameter in the evaluation of the azoospermic subject. Fertility and Sterility 1992 57 858–865.[Web of Science][Medline]

    55. Foresta C, Ferlin A, Garolla A, Rossato M, Barbaux S & De Bortoli A. Y-chromosome deletions in idiopathic severe testiculopathies. Journal of Clinical Endocrinology and Metabolism 1997 82 1075–1080.[Abstract/Free Full Text]

    56. Ferlin A, Moro E, Rossi A, Dallapiccola B & Foresta C. The human Y chromosome’s azoospermia factor b (AZFb) region: sequence, structure, and deletion analysis in infertile men. Journal of Medical Genetics 2003 40 18–24.[Abstract/Free Full Text]

    57. Ferlin A, Bettella A, Tessari A, Salata E, Dallapiccola B & Foresta C. Analysis of the DAZ gene family in cryptorchidism and idiopathic male infertility. Fertility and Sterility 2004 81 1013–1018.[CrossRef][Web of Science][Medline]

    58. Lubahn DB, Brown TR, Simental JA, Higgs HN, Migeon CJ, Wilson EM & French FS. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. PNAS 1989 86 9534–9538.[Abstract/Free Full Text]

    59. Staden R. The Staden sequence analysis package. Molecular Biotechnology 1996 5 233–241.[Web of Science][Medline]

    60. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Kohn FM, Schill WB, Farah S, Ramos C, Hartmann M, Hartschuh W, Meschede D, Behre HM, Castel A, Nieschlag E, Weidner W, Grone HJ, Jung A, Engel W & Haidl G. Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11G. Human Molecular Genetics 1996 5 933–943.[Abstract/Free Full Text]

    61. Foresta C, Moro E, Garolla A, Onisto M & Ferlin A. Y chromosome microdeletions in cryptorchidism and idiopathic infertility. Journal of Clinical Endocrinology and Metabolism 1999 84 3660–3665.[Abstract/Free Full Text]

    62. Foresta C, Moro E & Ferlin A. Y chromosome microdeletions and alterations of spermatogenesis. Endocrine Reviews 2001 22 226–239.[Abstract/Free Full Text]

    63. Zuccarello D, Morini E, Douzgou S, Ferlin A, Pizzuti A, Sampietro DC, Foresta C & Dallapiccola B. Preliminary data suggest that mutations in the CgRP pathway are not involved in human sporadic cryptorchidism. Journal of Endocrinological Investigation 2004 27 761–764.

    64. Bertini V, Bertelloni S, Valetto A, Lala R, Foresta C & Simi P. Homeobox HOXA10 gene analysis in cryptorchidism. Journal of Pediatric Endocrinology and Metabolism 2004 17 41–45.


Received 15 September 2004
Accepted 29 November 2004




This article has been cited by other articles:


Home page
JAMAHome page
A. Ferlin, D. Zuccarello, B. Zuccarello, M. R. Chirico, G. F. Zanon, and C. Foresta
Genetic Alterations Associated With Cryptorchidism
JAMA, November 19, 2008; 300(19): 2271 - 2276.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
A. Balestrieri, L. Zirilli, B. Madeo, E. Pignatti, G. Rossi, C. Carani, and V. Rochira
21-Hydroxylase Deficiency and Klinefelter Syndrome in an Adult Man: Striking a Balance Between Androgen Excess and Insufficiency
J Androl, November 1, 2008; 29(6): 605 - 609.
[Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Foresta, D. Zuccarello, A. Garolla, and A. Ferlin
Role of Hormones, Genes, and Environment in Human Cryptorchidism
Endocr. Rev., August 1, 2008; 29(5): 560 - 580.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
R. Radpour, M. Rezaee, A. Tavasoly, S. Solati, and A. Saleki
Association of Long Polyglycine Tracts (GGN Repeats) in Exon 1 of the Androgen Receptor Gene With Cryptorchidism and Penile Hypospadias in Iranian Patients
J Androl, January 1, 2007; 28(1): 164 - 169.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
E. Rajpert-De Meyts
Developmental model for the pathogenesis of testicular carcinoma in situ: genetic and environmental aspects
Hum. Reprod. Update, May 1, 2006; 12(3): 303 - 323.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferlin, A.
Right arrow Articles by Foresta, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferlin, A.
Right arrow Articles by Foresta, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS